Category: наука

Category was added automatically. Read all entries about "наука".

статистика, она все же наука

часто говорят, что периодические вспышки ковидлы имеют биологическую природу: ну там штамм новый злобный пришел, или иммунитет от прививки устарел и ослаб, или еще как подобно

нет, они культурно-социальные. идем туда, и смотрим на разделы тюрем и домов престарелых, то есть на часть популяции где социальная жизнь фиксирована. и пытаемся на тех графиках обнаружить вспышки
https://www.latimes.com/projects/california-coronavirus-cases-tracking-outbreak/
другое обьяснение я с удовольствием прочитаю

Все, что вы хотели узнать про вейсманизм-морганизм, но боялись

довоенная история "биологических" репрессий вымышленна чуть менее чем полностью
ни Лысенко лично, ни лидеры его движухи не имели никакого отношения к аресту и смерти Николая Вавилова. у Вавилова были свои собственные [теплые] отношения с режимом, несколько в русле древней байки о султане, ишаке и Насреддине. в какой то момент что то пошло не так
Агол и другие философы тоже поимели свои проблемы вне всякой связи с Лысенко
Четвериков был репрессирован тогда, когда лысенковщины даже в проекте не было
а Серебровский был завкафедрой генетики МГУ все эти годы

Все, что вы хотели узнать о происхождении САРС-2 вируса, но боялись

один из стандартных приемов, который используют научные шарлатаны для завоевания популярности в ширнармассах -- заявление, чти ихнее великое исследование/открытие якобы опровергает мейнстрим и разоблачает заговор научных элит. популистский прием достаточно эффективен, во многом потому, что первоисточников ширнармассы не читают
между тем мейнстримная, приблизительно общепринятая научная позиция состоит в том, что не известен источник  "However, it remains unclear which animals were the intermediate hosts and how it spilled over to humans." а так же время и и  географическое положение перехода Вируса на человека "When and where the earliest cross-species transmission of SARS-CoV-2 occurred from the intermediate host to humans has not been scientifically uncovered yet". отдельно и специально уточняется, что крайне вряд ли это произошло на Уханьском оптовом рынке " The Huanan seafood market may just be a crowded location where a cluster of early novel coronavirus patients were found. "
рассказала об этом Ши Чжэнли,  да та самая "batwoman" и главная негодяйка, уже скоро год как рассказала. но современным требователям разоблачения черной магии это не мешает совершенно

К вопросу о преподавании математики в университетах

можно сравнивать концентрации с концентрациями, количества с количествами

получаемое при вакцинации количество RCA много меньше количества допускаемого FDA при генной терапии

мне представляется, что сравнение количеств правильное. если какому то человеку опасен сахар, то что опаснее -- одна изюмина или банка кока-колы? в изюмине концентрация сахара выше. но в банке его -- 40 грамм
https://prof-afv.livejournal.com/76664.html?thread=4102776#t4102776

вторая волна

мне очень не нравится динамика числа новых случаев на восточном побережье US, там местами стабильно высокий уровень местами даже рост. прежде всего тем, что быть его вроде бы не должно: там было очень много переболевших весной, там была и вторая волна, там достаточно высокий процент чипированных... откуда материал?

наверное это можно обьяснить допустив, что
а) ковид гораздо менее заразен, чем принято думать
б) устойчивость к заражению у одного и того же человека сильно меняется во времени, в зависимости от стресса, усталости и прочей переменной физиологии

тогда возможно, что инфекция может заноситься в некоторый социальный пузырь, быстро там прокатывать по в_данный_момент_чувствительным и тем, кому не повезло. и исчезать. а когда через недели/месяцы ее ту опять случайно закидывают, то там уже новый чувствительный материал. и так много раз

много гитик наука не умеет

технологиям PCR писят лет, но точного решения выбора праймеров/проб/ампликонов нет до сих пор
вот кто бы мог предположить, что праймер
GGCTTTATATATCTTGTGGAAAGGACGAAACACC
будет поднимать RNA
GGAACAAGTCGGTCAGGAAGCCCGCGCGCAACAGCCATGGCTTTTAAGGATACCGGAAAAACACCCGTGG
с офигительной эффективностью? этой гомологии даже бласт не видит

што б их разорвало, всех троих

К истории русских литературных насекомых

https://avva.livejournal.com/3348725.html


существует совершенно серьезная научная монография на тему животных в "Слове о полку Игореве"
феноменальное чтиво. все было не так

UPD
скорее всего это, но я немного иначе помню биографию автора. впрочем, время издания приблизительно то и крайне вряд ли их было двое

http://feb-web.ru/feb/slovenc/es/es5/es5-0851.htm

Как же он служил в очистке

достаточно просто можно показать, почему отсутствие сексуального влечения к лицам противоположного пола [не] есть отклонение от биологической нормы. потом с аргументами можно спорить, с разной успешностью

но никак изначально нельзя корректно обосновать для высших млекопитающих наличие сексуального влечения к своему полу биологической ненормальностью

рыба, селедка, рыба

https://eis-gen.livejournal.com/8260.html